and goal: Adherence is a matter that impacts Complementary and Various Medication (CAM) and traditional drugs practitioners, whereby roughly half of the sufferers don’t take their medicines or treatments as prescribed. The session is an opportune space the place practitioners can have an effect on affected person adherence to therapy. As such, analysis was undertaken to discover this in depth inside one CAM.
The purpose of the examine was to know the Conventional Chinese language Medication (TCM) session course of that happens in relation to adherence and develop a session mannequin well being professionals can use.A classical grounded idea method was employed to semi-structured interviews of TCM practitioners and sufferers together with observations of their consultations.
Sampling was theoretical and by snowball in the UK. NVivo 11 was used to help with evaluation of the transcribed interviews and observations.Seven TCM practitioners and twenty-eight sufferers have been recruited.
TCM practitioners constructed a therapeutic relationship via the session by enabling sufferers to really feel comfy, valued as people which integrated feeling understood and identified, in addition to supported within the administration of their well being. Essentially, sufferers wanted to really feel cared for and have belief of their TCM practitioner for the therapeutic relationship to be established.
 EIF2S2 Antibody |
|
33102-100ul |
SAB |
100ul |
EUR 252 |
EIF2S2 Antibody |
|
1-CSB-PA070174 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
|
Description: A polyclonal antibody against EIF2S2. Recognizes EIF2S2 from Human. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000 |
EIF2S2 Antibody |
|
DF4050 |
Affbiotech |
200ul |
EUR 304 |
|
Description: EIF2S2 Antibody detects endogenous levels of total EIF2S2. |
 EIF2S2 antibody |
|
70R-36848 |
Fitzgerald |
100 ug |
EUR 327 |
|
Description: Rabbit Polyclonal EIF2S2 antibody |
EIF2S2 antibody |
|
70R-4904 |
Fitzgerald |
50 ug |
EUR 467 |
|
Description: Rabbit polyclonal EIF2S2 antibody raised against the N terminal of EIF2S2 |
EIF2S2 antibody |
|
70R-4905 |
Fitzgerald |
50 ug |
EUR 467 |
|
Description: Rabbit polyclonal EIF2S2 antibody raised against the N terminal of EIF2S2 |
EIF2S2 Antibody |
|
1-CSB-PA010574 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
|
Description: A polyclonal antibody against EIF2S2. Recognizes EIF2S2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/10000 |
EIF2S2 Antibody |
|
1-CSB-PA007524GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
|
Description: A polyclonal antibody against EIF2S2. Recognizes EIF2S2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF |
 EIF2S2 siRNA |
|
20-abx915153 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
EIF2S2 siRNA |
|
20-abx915154 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 EIF2S2 Rabbit pAb |
|
A14498-100ul |
Abclonal |
100 ul |
EUR 308 |
EIF2S2 Rabbit pAb |
|
A14498-200ul |
Abclonal |
200 ul |
EUR 459 |
EIF2S2 Rabbit pAb |
|
A14498-20ul |
Abclonal |
20 ul |
EUR 183 |
EIF2S2 Rabbit pAb |
|
A14498-50ul |
Abclonal |
50 ul |
EUR 223 |
 EIF2S2 Blocking Peptide |
|
33R-1911 |
Fitzgerald |
100 ug |
EUR 180 |
|
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of EIF2S2 antibody, catalog no. 70R-4904 |
EIF2S2 Blocking Peptide |
|
33R-9251 |
Fitzgerald |
100 ug |
EUR 180 |
|
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of EIF2S2 antibody, catalog no. 70R-4905 |
EIF2S2 Blocking Peptide |
|
DF4050-BP |
Affbiotech |
1mg |
EUR 195 |
 Antibody) EIF2S2 (pS67) Antibody |
|
20-abx121086 |
Abbexa |
-
EUR 314.00
-
EUR 467.00
-
EUR 203.00
|
|
- Shipped within 5-10 working days.
|
 EIF2S2 Conjugated Antibody |
|
C33102 |
SAB |
100ul |
EUR 397 |
 EIF2S2 cloning plasmid |
|
CSB-CL007524HU1-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1002
- Sequence: atgtctggggacgagatgatttttgatcctactatgagcaagaagaaaaagaagaagaagaagccttttatgttagatgaggaaggggatacccaaacagaggaaacccagccttcagaaacaaaagaagtggagccagagccaactgaggacaaggatttggaagctgatgaag
- Show more
|
|
Description: A cloning plasmid for the EIF2S2 gene. |
EIF2S2 cloning plasmid |
|
CSB-CL007524HU2-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 645
- Sequence: atgcttggcaataaaaagaagaaaaagaagaatgttaagttcccagatgaggatgaaatactagagaaagatgaagctctagaagatgaagacaacaaaaaagatgatggtatctcattcagtaatcagacaggccctgcttgggcaggctcagaaagagactacacatacgagga
- Show more
|
|
Description: A cloning plasmid for the EIF2S2 gene. |
EIF2S2 cloning plasmid |
|
CSB-CL007524HU3-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1002
- Sequence: atgtctggggacgagatgatttttgatcctactatgagcaagaagaaaaagaagaagaagaagccttttatgttagatgaggaaggggatacccaaacagaggaaacccagccttcagaaacaaaagaagtggagccagagccaactgaggacaaggatttggaagctgatgaag
- Show more
|
|
Description: A cloning plasmid for the EIF2S2 gene. |
EIF2S2 Rabbit pAb |
|
A5894-100ul |
Abclonal |
100 ul |
EUR 308 |
EIF2S2 Rabbit pAb |
|
A5894-200ul |
Abclonal |
200 ul |
EUR 459 |
EIF2S2 Rabbit pAb |
|
A5894-20ul |
Abclonal |
20 ul |
EUR 183 |
EIF2S2 Rabbit pAb |
|
A5894-50ul |
Abclonal |
50 ul |
EUR 223 |
 Antibody) EIF2S2 (pS2) Antibody |
|
20-abx000391 |
Abbexa |
-
EUR 495.00
-
EUR 704.00
-
EUR 356.00
|
|
- Shipped within 5-10 working days.
|
 anti- EIF2S2 antibody |
|
FNab02700 |
FN Test |
100µg |
EUR 548.75 |
- Immunogen: eukaryotic translation initiation factor 2, subunit 2 beta, 38kDa
- Uniprot ID: P20042
- Gene ID: 8894
- Research Area: Metabolism
|
|
Description: Antibody raised against EIF2S2 |
 Anti-EIF2S2 Antibody |
|
PA2157 |
BosterBio |
100ug/vial |
EUR 294 |
 Anti-EIF2S2 antibody |
|
STJ28167 |
St John's Laboratory |
100 µl |
EUR 277 |
|
Description: Eukaryotic translation initiation factor 2 (EIF-2) functions in the early steps of protein synthesis by forming a ternary complex with GTP and initiator tRNA and binding to a 40S ribosomal subunit. EIF-2 is composed of three subunits, alpha, beta, and gamma, with the protein encoded by this gene representing the beta subunit. The beta subunit catalyzes the exchange of GDP for GTP, which recycles the EIF-2 complex for another round of initiation. Multiple transcript variants encoding different isoforms have been found for this gene. |
Anti-EIF2S2 antibody |
|
STJ116709 |
St John's Laboratory |
100 µl |
EUR 277 |
|
Description: Eukaryotic translation initiation factor 2 (EIF-2) functions in the early steps of protein synthesis by forming a ternary complex with GTP and initiator tRNA and binding to a 40S ribosomal subunit. EIF-2 is composed of three subunits, alpha, beta, and gamma, with the protein encoded by this gene representing the beta subunit. The beta subunit catalyzes the exchange of GDP for GTP, which recycles the EIF-2 complex for another round of initiation. Multiple transcript variants encoding different isoforms have been found for this gene. |
) Anti-EIF2S2 (2F3) |
|
YF-MA16593 |
Abfrontier |
100 ug |
EUR 363 |
|
Description: Mouse monoclonal to EIF2S2 |
 Antibody) Phospho-EIF2S2 (Ser2) Antibody |
|
CSB-PA790061- |
Cusabio |
|
EUR 335 |
- Form: liquid
- Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo
- Show more
|
|
Description: A polyclonal antibody against Phospho-EIF2S2 (Ser2). Recognizes Phospho-EIF2S2 (Ser2) from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000 |
Phospho-EIF2S2 (Ser2) Antibody |
|
CSB-PA790061-100ul |
Cusabio |
100ul |
EUR 362 |
- Form: liquid
- Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo
- Show more
|
|
Description: A polyclonal antibody against Phospho-EIF2S2 (Ser2). Recognizes Phospho-EIF2S2 (Ser2) from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000 |
 Antibody) EIF2S2 (Ab-67) Antibody |
|
CSB-PA566738- |
Cusabio |
|
EUR 335 |
- Form: liquid
- Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
- Show more
|
|
Description: A polyclonal antibody against EIF2S2 (Ab-67). Recognizes EIF2S2 (Ab-67) from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000 |
EIF2S2 (Ab-67) Antibody |
|
CSB-PA566738-100ul |
Cusabio |
100ul |
EUR 316 |
- Form: liquid
- Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
- Show more
|
|
Description: A polyclonal antibody against EIF2S2 (Ab-67). Recognizes EIF2S2 (Ab-67) from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000 |
 Blocking Peptide) EIF2S2 (pS67) Blocking Peptide |
|
20-abx161086 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 Mouse EIF2S2 shRNA Plasmid |
|
20-abx976031 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Human EIF2S2 shRNA Plasmid |
|
20-abx955879 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
) EIF2S2 Recombinant Protein (Human) |
|
RP010384 |
ABM |
100 ug |
Ask for price |
EIF2S2 Recombinant Protein (Human) |
|
RP010387 |
ABM |
100 ug |
Ask for price |
EIF2S2 Recombinant Protein (Human) |
|
RP010390 |
ABM |
100 ug |
Ask for price |
) EIF2S2 Recombinant Protein (Rat) |
|
RP199331 |
ABM |
100 ug |
Ask for price |
) EIF2S2 Recombinant Protein (Mouse) |
|
RP131258 |
ABM |
100 ug |
Ask for price |
 Phospho-EIF2S2-S2 Rabbit pAb |
|
AP0343-100ul |
Abclonal |
100 ul |
EUR 384 |
Phospho-EIF2S2-S2 Rabbit pAb |
|
AP0343-200ul |
Abclonal |
200 ul |
EUR 554 |
Phospho-EIF2S2-S2 Rabbit pAb |
|
AP0343-20ul |
Abclonal |
20 ul |
Ask for price |
Phospho-EIF2S2-S2 Rabbit pAb |
|
AP0343-50ul |
Abclonal |
50 ul |
EUR 265 |
 (pORF)) Eif2s2 ORF Vector (Rat) (pORF) |
|
ORF066445 |
ABM |
1.0 ug DNA |
EUR 506 |
 (pORF)) EIF2S2 ORF Vector (Human) (pORF) |
|
ORF003462 |
ABM |
1.0 ug DNA |
EUR 95 |
EIF2S2 ORF Vector (Human) (pORF) |
|
ORF003463 |
ABM |
1.0 ug DNA |
EUR 95 |
EIF2S2 ORF Vector (Human) (pORF) |
|
ORF003464 |
ABM |
1.0 ug DNA |
EUR 95 |
 (pORF)) Eif2s2 ORF Vector (Mouse) (pORF) |
|
ORF043754 |
ABM |
1.0 ug DNA |
EUR 506 |
 antibody) Anti-Phospho-EIF2S2-(S2) antibody |
|
STJ22114 |
St John's Laboratory |
100 µl |
EUR 393 |
|
Description: Eukaryotic translation initiation factor 2 (EIF-2) functions in the early steps of protein synthesis by forming a ternary complex with GTP and initiator tRNA and binding to a 40S ribosomal subunit. EIF-2 is composed of three subunits, alpha, beta, and gamma, with the protein encoded by this gene representing the beta subunit. The beta subunit catalyzes the exchange of GDP for GTP, which recycles the EIF-2 complex for another round of initiation. Multiple transcript variants encoding different isoforms have been found for this gene. |
) Eif2s2 sgRNA CRISPR Lentivector set (Mouse) |
|
K4867501 |
ABM |
3 x 1.0 ug |
EUR 339 |
) EIF2S2 sgRNA CRISPR Lentivector set (Human) |
|
K0666501 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Eif2s2 sgRNA CRISPR Lentivector set (Rat) |
|
K7228601 |
ABM |
3 x 1.0 ug |
EUR 339 |
 (Target 1)) Eif2s2 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
|
K4867502 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Eif2s2 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
|
K4867503 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Eif2s2 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
|
K4867504 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) EIF2S2 sgRNA CRISPR Lentivector (Human) (Target 1) |
|
K0666502 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) EIF2S2 sgRNA CRISPR Lentivector (Human) (Target 2) |
|
K0666503 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) EIF2S2 sgRNA CRISPR Lentivector (Human) (Target 3) |
|
K0666504 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) Eif2s2 sgRNA CRISPR Lentivector (Rat) (Target 1) |
|
K7228602 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Eif2s2 sgRNA CRISPR Lentivector (Rat) (Target 2) |
|
K7228603 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Eif2s2 sgRNA CRISPR Lentivector (Rat) (Target 3) |
|
K7228604 |
ABM |
1.0 ug DNA |
EUR 154 |
 (pPB-C-His)) EIF2S2 Protein Vector (Mouse) (pPB-C-His) |
|
PV175014 |
ABM |
500 ng |
EUR 603 |
 (pPB-N-His)) EIF2S2 Protein Vector (Mouse) (pPB-N-His) |
|
PV175015 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-HA)) EIF2S2 Protein Vector (Mouse) (pPM-C-HA) |
|
PV175016 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-His)) EIF2S2 Protein Vector (Mouse) (pPM-C-His) |
|
PV175017 |
ABM |
500 ng |
EUR 603 |
 (pPB-C-His)) EIF2S2 Protein Vector (Rat) (pPB-C-His) |
|
PV265778 |
ABM |
500 ng |
EUR 603 |
 (pPB-N-His)) EIF2S2 Protein Vector (Rat) (pPB-N-His) |
|
PV265779 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-HA)) EIF2S2 Protein Vector (Rat) (pPM-C-HA) |
|
PV265780 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-His)) EIF2S2 Protein Vector (Rat) (pPM-C-His) |
|
PV265781 |
ABM |
500 ng |
EUR 603 |
 (pPB-C-His)) EIF2S2 Protein Vector (Human) (pPB-C-His) |
|
PV013845 |
ABM |
500 ng |
EUR 329 |
 (pPB-N-His)) EIF2S2 Protein Vector (Human) (pPB-N-His) |
|
PV013846 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-HA)) EIF2S2 Protein Vector (Human) (pPM-C-HA) |
|
PV013847 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-His)) EIF2S2 Protein Vector (Human) (pPM-C-His) |
|
PV013848 |
ABM |
500 ng |
EUR 329 |
EIF2S2 Protein Vector (Human) (pPB-C-His) |
|
PV013849 |
ABM |
500 ng |
EUR 329 |
EIF2S2 Protein Vector (Human) (pPB-N-His) |
|
PV013850 |
ABM |
500 ng |
EUR 329 |
EIF2S2 Protein Vector (Human) (pPM-C-HA) |
|
PV013851 |
ABM |
500 ng |
EUR 329 |
EIF2S2 Protein Vector (Human) (pPM-C-His) |
|
PV013852 |
ABM |
500 ng |
EUR 329 |
EIF2S2 Protein Vector (Human) (pPB-C-His) |
|
PV013853 |
ABM |
500 ng |
EUR 329 |
EIF2S2 Protein Vector (Human) (pPB-N-His) |
|
PV013854 |
ABM |
500 ng |
EUR 329 |
EIF2S2 Protein Vector (Human) (pPM-C-HA) |
|
PV013855 |
ABM |
500 ng |
EUR 329 |
EIF2S2 Protein Vector (Human) (pPM-C-His) |
|
PV013856 |
ABM |
500 ng |
EUR 329 |
 Eif2s2 3'UTR GFP Stable Cell Line |
|
TU155710 |
ABM |
1.0 ml |
Ask for price |
 Eif2s2 3'UTR Luciferase Stable Cell Line |
|
TU105710 |
ABM |
1.0 ml |
Ask for price |
Eif2s2 3'UTR Luciferase Stable Cell Line |
|
TU203877 |
ABM |
1.0 ml |
Ask for price |
This motivated sufferers to proceed with therapy.The TCM Session Mannequin for Adherence was developed to conceptualise the session course of that happens in relation to adherence. It may be used to encourage affected person persistence with therapy by TCM practitioners and doubtlessly different well being professionals.
