Understanding the Traditional Chinese Medicine (TCM) consultation: Why do patients adhere to treatment?

and goal: Adherence is a matter that impacts Complementary and Various Medication (CAM) and traditional drugs practitioners, whereby roughly half of the sufferers don’t take their medicines or treatments as prescribed. The session is an opportune space the place practitioners can have an effect on affected person adherence to therapy. As such, analysis was undertaken to discover this in depth inside one CAM.

The purpose of the examine was to know the Conventional Chinese language Medication (TCM) session course of that happens in relation to adherence and develop a session mannequin well being professionals can use.A classical grounded idea method was employed to semi-structured interviews of TCM practitioners and sufferers together with observations of their consultations.

Sampling was theoretical and by snowball in the UK. NVivo 11 was used to help with evaluation of the transcribed interviews and observations.Seven TCM practitioners and twenty-eight sufferers have been recruited.

TCM practitioners constructed a therapeutic relationship via the session by enabling sufferers to really feel comfy, valued as people which integrated feeling understood and identified, in addition to supported within the administration of their well being. Essentially, sufferers wanted to really feel cared for and have belief of their TCM practitioner for the therapeutic relationship to be established.

EIF2S2 Antibody

33102-100ul 100ul
EUR 252

EIF2S2 Antibody

1-CSB-PA070174
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against EIF2S2. Recognizes EIF2S2 from Human. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000

EIF2S2 Antibody

DF4050 200ul
EUR 304
Description: EIF2S2 Antibody detects endogenous levels of total EIF2S2.

EIF2S2 antibody

70R-36848 100 ug
EUR 327
Description: Rabbit Polyclonal EIF2S2 antibody

EIF2S2 antibody

70R-4904 50 ug
EUR 467
Description: Rabbit polyclonal EIF2S2 antibody raised against the N terminal of EIF2S2

EIF2S2 antibody

70R-4905 50 ug
EUR 467
Description: Rabbit polyclonal EIF2S2 antibody raised against the N terminal of EIF2S2

EIF2S2 Antibody

1-CSB-PA010574
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against EIF2S2. Recognizes EIF2S2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/10000

EIF2S2 Antibody

1-CSB-PA007524GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against EIF2S2. Recognizes EIF2S2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF

EIF2S2 siRNA

20-abx915153
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

EIF2S2 siRNA

20-abx915154
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

EIF2S2 Antibody

ABD4050 100 ug
EUR 438

pOTB7-EIF2S2

PVT18393 2 ug
EUR 231

EIF2S2 Rabbit pAb

A14498-100ul 100 ul
EUR 308

EIF2S2 Rabbit pAb

A14498-200ul 200 ul
EUR 459

EIF2S2 Rabbit pAb

A14498-20ul 20 ul
EUR 183

EIF2S2 Rabbit pAb

A14498-50ul 50 ul
EUR 223

EIF2S2 Blocking Peptide

33R-1911 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of EIF2S2 antibody, catalog no. 70R-4904

EIF2S2 Blocking Peptide

33R-9251 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of EIF2S2 antibody, catalog no. 70R-4905

EIF2S2 Blocking Peptide

DF4050-BP 1mg
EUR 195

EIF2S2 (pS67) Antibody

20-abx121086
  • EUR 314.00
  • EUR 467.00
  • EUR 203.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

EIF2S2 Conjugated Antibody

C33102 100ul
EUR 397

EIF2S2 cloning plasmid

CSB-CL007524HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1002
  • Sequence: atgtctggggacgagatgatttttgatcctactatgagcaagaagaaaaagaagaagaagaagccttttatgttagatgaggaaggggatacccaaacagaggaaacccagccttcagaaacaaaagaagtggagccagagccaactgaggacaaggatttggaagctgatgaag
  • Show more
Description: A cloning plasmid for the EIF2S2 gene.

EIF2S2 cloning plasmid

CSB-CL007524HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 645
  • Sequence: atgcttggcaataaaaagaagaaaaagaagaatgttaagttcccagatgaggatgaaatactagagaaagatgaagctctagaagatgaagacaacaaaaaagatgatggtatctcattcagtaatcagacaggccctgcttgggcaggctcagaaagagactacacatacgagga
  • Show more
Description: A cloning plasmid for the EIF2S2 gene.

EIF2S2 cloning plasmid

CSB-CL007524HU3-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1002
  • Sequence: atgtctggggacgagatgatttttgatcctactatgagcaagaagaaaaagaagaagaagaagccttttatgttagatgaggaaggggatacccaaacagaggaaacccagccttcagaaacaaaagaagtggagccagagccaactgaggacaaggatttggaagctgatgaag
  • Show more
Description: A cloning plasmid for the EIF2S2 gene.

EIF2S2 Rabbit pAb

A5894-100ul 100 ul
EUR 308

EIF2S2 Rabbit pAb

A5894-200ul 200 ul
EUR 459

EIF2S2 Rabbit pAb

A5894-20ul 20 ul
EUR 183

EIF2S2 Rabbit pAb

A5894-50ul 50 ul
EUR 223

EIF2S2 (pS2) Antibody

20-abx000391
  • EUR 495.00
  • EUR 704.00
  • EUR 356.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

anti- EIF2S2 antibody

FNab02700 100µg
EUR 548.75
  • Immunogen: eukaryotic translation initiation factor 2, subunit 2 beta, 38kDa
  • Uniprot ID: P20042
  • Gene ID: 8894
  • Research Area: Metabolism
Description: Antibody raised against EIF2S2

Anti-EIF2S2 Antibody

PA2157 100ug/vial
EUR 294

Anti-EIF2S2 antibody

PAab02700 100 ug
EUR 386

pENTR223-EIF2S2 vector

PVT11718 2 ug
EUR 304

pCMV-SPORT6-EIF2S2

PVT18199 2 ug
EUR 231

Anti-EIF2S2 antibody

STJ28167 100 µl
EUR 277
Description: Eukaryotic translation initiation factor 2 (EIF-2) functions in the early steps of protein synthesis by forming a ternary complex with GTP and initiator tRNA and binding to a 40S ribosomal subunit. EIF-2 is composed of three subunits, alpha, beta, and gamma, with the protein encoded by this gene representing the beta subunit. The beta subunit catalyzes the exchange of GDP for GTP, which recycles the EIF-2 complex for another round of initiation. Multiple transcript variants encoding different isoforms have been found for this gene.

Anti-EIF2S2 antibody

STJ116709 100 µl
EUR 277
Description: Eukaryotic translation initiation factor 2 (EIF-2) functions in the early steps of protein synthesis by forming a ternary complex with GTP and initiator tRNA and binding to a 40S ribosomal subunit. EIF-2 is composed of three subunits, alpha, beta, and gamma, with the protein encoded by this gene representing the beta subunit. The beta subunit catalyzes the exchange of GDP for GTP, which recycles the EIF-2 complex for another round of initiation. Multiple transcript variants encoding different isoforms have been found for this gene.

Anti-EIF2S2 (2F3)

YF-MA16593 100 ug
EUR 363
Description: Mouse monoclonal to EIF2S2

Phospho-EIF2S2 (Ser2) Antibody

CSB-PA790061-
EUR 335
  • Form: liquid
  • Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo
  • Show more
Description: A polyclonal antibody against Phospho-EIF2S2 (Ser2). Recognizes Phospho-EIF2S2 (Ser2) from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

Phospho-EIF2S2 (Ser2) Antibody

CSB-PA790061-100ul 100ul
EUR 362
  • Form: liquid
  • Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo
  • Show more
Description: A polyclonal antibody against Phospho-EIF2S2 (Ser2). Recognizes Phospho-EIF2S2 (Ser2) from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

EIF2S2 (Ab-67) Antibody

CSB-PA566738-
EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against EIF2S2 (Ab-67). Recognizes EIF2S2 (Ab-67) from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

EIF2S2 (Ab-67) Antibody

CSB-PA566738-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against EIF2S2 (Ab-67). Recognizes EIF2S2 (Ab-67) from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

EIF2S2 (pS67) Blocking Peptide

20-abx161086
  • EUR 314.00
  • EUR 509.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

Bovine EIF2S2 ELISA KIT

ELI-08424b 96 Tests
EUR 928

EIF2S2 ELISA KIT|Human

EF009336 96 Tests
EUR 689

Human EIF2S2 ELISA KIT

ELI-43377h 96 Tests
EUR 824

Mouse EIF2S2 shRNA Plasmid

20-abx976031
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human EIF2S2 shRNA Plasmid

20-abx955879
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse Eif2s2 ELISA KIT

ELI-48691m 96 Tests
EUR 865

pECMV-3-FLAG-EIF2S2

PVT13567 2 ug
EUR 599

EIF2S2 Recombinant Protein (Human)

RP010384 100 ug Ask for price

EIF2S2 Recombinant Protein (Human)

RP010387 100 ug Ask for price

EIF2S2 Recombinant Protein (Human)

RP010390 100 ug Ask for price

EIF2S2 Recombinant Protein (Rat)

RP199331 100 ug Ask for price

EIF2S2 Recombinant Protein (Mouse)

RP131258 100 ug Ask for price

Phospho-EIF2S2-S2 Rabbit pAb

AP0343-100ul 100 ul
EUR 384

Phospho-EIF2S2-S2 Rabbit pAb

AP0343-200ul 200 ul
EUR 554

Phospho-EIF2S2-S2 Rabbit pAb

AP0343-20ul 20 ul Ask for price

Phospho-EIF2S2-S2 Rabbit pAb

AP0343-50ul 50 ul
EUR 265

Eif2s2 ORF Vector (Rat) (pORF)

ORF066445 1.0 ug DNA
EUR 506

EIF2S2 ORF Vector (Human) (pORF)

ORF003462 1.0 ug DNA
EUR 95

EIF2S2 ORF Vector (Human) (pORF)

ORF003463 1.0 ug DNA
EUR 95

EIF2S2 ORF Vector (Human) (pORF)

ORF003464 1.0 ug DNA
EUR 95

Eif2s2 ORF Vector (Mouse) (pORF)

ORF043754 1.0 ug DNA
EUR 506

Anti-Phospho-EIF2S2-(S2) antibody

STJ22114 100 µl
EUR 393
Description: Eukaryotic translation initiation factor 2 (EIF-2) functions in the early steps of protein synthesis by forming a ternary complex with GTP and initiator tRNA and binding to a 40S ribosomal subunit. EIF-2 is composed of three subunits, alpha, beta, and gamma, with the protein encoded by this gene representing the beta subunit. The beta subunit catalyzes the exchange of GDP for GTP, which recycles the EIF-2 complex for another round of initiation. Multiple transcript variants encoding different isoforms have been found for this gene.

Eif2s2 sgRNA CRISPR Lentivector set (Mouse)

K4867501 3 x 1.0 ug
EUR 339

EIF2S2 sgRNA CRISPR Lentivector set (Human)

K0666501 3 x 1.0 ug
EUR 339

Eif2s2 sgRNA CRISPR Lentivector set (Rat)

K7228601 3 x 1.0 ug
EUR 339

Eif2s2 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4867502 1.0 ug DNA
EUR 154

Eif2s2 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4867503 1.0 ug DNA
EUR 154

Eif2s2 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4867504 1.0 ug DNA
EUR 154

EIF2S2 sgRNA CRISPR Lentivector (Human) (Target 1)

K0666502 1.0 ug DNA
EUR 154

EIF2S2 sgRNA CRISPR Lentivector (Human) (Target 2)

K0666503 1.0 ug DNA
EUR 154

EIF2S2 sgRNA CRISPR Lentivector (Human) (Target 3)

K0666504 1.0 ug DNA
EUR 154

Eif2s2 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7228602 1.0 ug DNA
EUR 154

Eif2s2 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7228603 1.0 ug DNA
EUR 154

Eif2s2 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7228604 1.0 ug DNA
EUR 154

EIF2S2 Protein Vector (Mouse) (pPB-C-His)

PV175014 500 ng
EUR 603

EIF2S2 Protein Vector (Mouse) (pPB-N-His)

PV175015 500 ng
EUR 603

EIF2S2 Protein Vector (Mouse) (pPM-C-HA)

PV175016 500 ng
EUR 603

EIF2S2 Protein Vector (Mouse) (pPM-C-His)

PV175017 500 ng
EUR 603

EIF2S2 Protein Vector (Rat) (pPB-C-His)

PV265778 500 ng
EUR 603

EIF2S2 Protein Vector (Rat) (pPB-N-His)

PV265779 500 ng
EUR 603

EIF2S2 Protein Vector (Rat) (pPM-C-HA)

PV265780 500 ng
EUR 603

EIF2S2 Protein Vector (Rat) (pPM-C-His)

PV265781 500 ng
EUR 603

EIF2S2 Protein Vector (Human) (pPB-C-His)

PV013845 500 ng
EUR 329

EIF2S2 Protein Vector (Human) (pPB-N-His)

PV013846 500 ng
EUR 329

EIF2S2 Protein Vector (Human) (pPM-C-HA)

PV013847 500 ng
EUR 329

EIF2S2 Protein Vector (Human) (pPM-C-His)

PV013848 500 ng
EUR 329

EIF2S2 Protein Vector (Human) (pPB-C-His)

PV013849 500 ng
EUR 329

EIF2S2 Protein Vector (Human) (pPB-N-His)

PV013850 500 ng
EUR 329

EIF2S2 Protein Vector (Human) (pPM-C-HA)

PV013851 500 ng
EUR 329

EIF2S2 Protein Vector (Human) (pPM-C-His)

PV013852 500 ng
EUR 329

EIF2S2 Protein Vector (Human) (pPB-C-His)

PV013853 500 ng
EUR 329

EIF2S2 Protein Vector (Human) (pPB-N-His)

PV013854 500 ng
EUR 329

EIF2S2 Protein Vector (Human) (pPM-C-HA)

PV013855 500 ng
EUR 329

EIF2S2 Protein Vector (Human) (pPM-C-His)

PV013856 500 ng
EUR 329

Eif2s2 3'UTR GFP Stable Cell Line

TU155710 1.0 ml Ask for price

Eif2s2 3'UTR Luciferase Stable Cell Line

TU105710 1.0 ml Ask for price

Eif2s2 3'UTR Luciferase Stable Cell Line

TU203877 1.0 ml Ask for price

Eif2s2 3'UTR GFP Stable Cell Line

TU253877 1.0 ml Ask for price

EIF2S2 3'UTR GFP Stable Cell Line

TU056719 1.0 ml
EUR 1394

EIF2S2 3'UTR Luciferase Stable Cell Line

TU006719 1.0 ml
EUR 1394

Rabbit Anti-Human EIF2S2 Polyclonal Antibody, phospho-Ser2

CPB-1265RH 100 ul
EUR 559

EIF2S2 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV709647 1.0 ug DNA
EUR 316

EIF2S2 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV709651 1.0 ug DNA
EUR 316

EIF2S2 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV709652 1.0 ug DNA
EUR 316

EIF2S2 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV709653 1.0 ug DNA
EUR 316

EIF2S2 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV709657 1.0 ug DNA
EUR 316

EIF2S2 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV709658 1.0 ug DNA
EUR 316

EIF2S2 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV629899 1.0 ug DNA
EUR 682

EIF2S2 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV629903 1.0 ug DNA
EUR 682

EIF2S2 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV629904 1.0 ug DNA
EUR 682

Eukaryotic Translation Initiation Factor 2 Subunit 2 (EIF2S2) Antibody

20-abx004521
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Eukaryotic Translation Initiation Factor 2 Subunit 2 (EIF2S2) Antibody

20-abx112360
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Eukaryotic Translation Initiation Factor 2 Subunit 2 (EIF2S2) Antibody

abx031481-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Eukaryotic Translation Initiation Factor 2 Subunit 2 (EIF2S2) Antibody

abx031481-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Eukaryotic Translation Initiation Factor 2 Subunit 2 (EIF2S2) Antibody

abx331895-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.

Eukaryotic Translation Initiation Factor 2 Subunit 2 (EIF2S2) Antibody

20-abx325737
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Eukaryotic Translation Initiation Factor 2 Subunit 2 (EIF2S2) Antibody

20-abx323699
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Eukaryotic Translation Initiation Factor 2 Subunit 2 (EIF2S2) Antibody

abx232700-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Eif2s2 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K4867505 3 x 1.0 ug
EUR 376

EIF2S2 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K0666505 3 x 1.0 ug
EUR 376

Eif2s2 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K7228605 3 x 1.0 ug
EUR 376

Human Eukaryotic Translation Initiation Factor 2 Subunit 2 (EIF2S2) ELISA Kit

abx387091-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Eif2s2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)

K4867506 1.0 ug DNA
EUR 167

Eif2s2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)

K4867507 1.0 ug DNA
EUR 167

Eif2s2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)

K4867508 1.0 ug DNA
EUR 167

EIF2S2 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-C-term-HA)

LV709648 1.0 ug DNA
EUR 316

EIF2S2 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)

LV709649 1.0 ug DNA
EUR 374

EIF2S2 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)

LV709650 1.0 ug DNA
EUR 374

EIF2S2 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-C-term-HA)

LV709654 1.0 ug DNA
EUR 316

EIF2S2 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)

LV709655 1.0 ug DNA
EUR 374

EIF2S2 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)

LV709656 1.0 ug DNA
EUR 374

EIF2S2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K0666506 1.0 ug DNA
EUR 167

EIF2S2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K0666507 1.0 ug DNA
EUR 167

EIF2S2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K0666508 1.0 ug DNA
EUR 167

EIF2S2 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)

LV629900 1.0 ug DNA
EUR 682

EIF2S2 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)

LV629901 1.0 ug DNA
EUR 740

EIF2S2 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)

LV629902 1.0 ug DNA
EUR 740

Eif2s2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)

K7228606 1.0 ug DNA
EUR 167

Eif2s2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)

K7228607 1.0 ug DNA
EUR 167

Eif2s2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)

K7228608 1.0 ug DNA
EUR 167

Eukaryotic Translation Initiation Factor 2 Subunit 2 Phospho-Ser2 (EIF2S2 pS2) Antibody

abx333016-100ul 100 ul
EUR 467
  • Shipped within 5-10 working days.

This motivated sufferers to proceed with therapy.The TCM Session Mannequin for Adherence was developed to conceptualise the session course of that happens in relation to adherence. It may be used to encourage affected person persistence with therapy by TCM practitioners and doubtlessly different well being professionals.

Scroll to Top