Since there’s a shift from consuming lunch at house to consuming lunch at main colleges within the Netherlands, offering a faculty lunch could also be an vital alternative to enhance the weight loss program high quality of Dutch youngsters.
Due to this fact, the intention of this Wholesome College Lunch venture is to encourage wholesome consuming conduct of youngsters at main colleges by providing a wholesome college lunch, primarily based on the rules for a nutritious diet. On this research, two analysis questions might be addressed.
The primary analysis query is: What and the way a lot do youngsters eat from a self-served college lunch and the way do they consider the lunch? The second analysis query is: Do youngsters compensate more healthy college lunches by consuming much less wholesome exterior college hours?
 EIF2B4 antibody |
|
70R-17041 |
Fitzgerald |
50 ul |
EUR 435 |
|
Description: Rabbit polyclonal EIF2B4 antibody |
 EIF2B4 Antibody |
|
35107-100ul |
SAB |
100ul |
EUR 252 |
EIF2B4 Antibody |
|
35107-50ul |
SAB |
50ul |
EUR 187 |
EIF2B4 Antibody |
|
CSB-PA933060- |
Cusabio |
|
EUR 335 |
- Form: liquid
- Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
- Show more
|
|
Description: A polyclonal antibody against EIF2B4. Recognizes EIF2B4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000 |
EIF2B4 Antibody |
|
CSB-PA933060-100ul |
Cusabio |
100ul |
EUR 316 |
- Form: liquid
- Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
- Show more
|
|
Description: A polyclonal antibody against EIF2B4. Recognizes EIF2B4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000 |
EIF2B4 Antibody |
|
DF4577 |
Affbiotech |
200ul |
EUR 304 |
|
Description: EIF2B4 Antibody detects endogenous levels of total EIF2B4. |
EIF2B4 antibody |
|
70R-36819 |
Fitzgerald |
100 ug |
EUR 349 |
|
Description: Rabbit Polyclonal EIF2B4 antibody |
EIF2B4 Antibody |
|
1-CSB-PA010573 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
|
Description: A polyclonal antibody against EIF2B4. Recognizes EIF2B4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/5000 |
EIF2B4 Antibody |
|
1-CSB-PA007517GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
|
Description: A polyclonal antibody against EIF2B4. Recognizes EIF2B4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC |
 EIF2B4 siRNA |
|
20-abx901674 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
EIF2B4 siRNA |
|
20-abx915145 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
EIF2B4 siRNA |
|
20-abx915146 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 EIF2B4 Blocking Peptide |
|
DF4577-BP |
Affbiotech |
1mg |
EUR 195 |
EIF2B4 Blocking Peptide |
|
20-abx161838 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 EIF2B4 Conjugated Antibody |
|
C35107 |
SAB |
100ul |
EUR 397 |
 EIF2B4 cloning plasmid |
|
CSB-CL887053HU-10ug |
Cusabio |
10ug |
EUR 376 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1572
- Sequence: atggctgctgtggccgtggctgttcgcgaggactcgggatccgggatgaaggcggagcttccccctgggcctggggcagtggggagggaaatgaccaaagaagaaaagctgcagcttcggaaggaaaagaaacagcagaagaagaaacggaaggaagaaaagggggcagaaccag
- Show more
|
|
Description: A cloning plasmid for the EIF2B4 gene. |
 EIF2B4 Rabbit pAb |
|
A18203-100ul |
Abclonal |
100 ul |
EUR 308 |
EIF2B4 Rabbit pAb |
|
A18203-200ul |
Abclonal |
200 ul |
EUR 459 |
EIF2B4 Rabbit pAb |
|
A18203-20ul |
Abclonal |
20 ul |
EUR 183 |
EIF2B4 Rabbit pAb |
|
A18203-50ul |
Abclonal |
50 ul |
EUR 223 |
 anti- EIF2B4 antibody |
|
FNab02696 |
FN Test |
100µg |
EUR 505.25 |
- Immunogen: eukaryotic translation initiation factor 2B, subunit 4 delta, 67kDa
- Uniprot ID: Q9UI10
- Gene ID: 8890
- Research Area: Metabolism
|
|
Description: Antibody raised against EIF2B4 |
 Anti-EIF2B4 antibody |
|
STJ11100161 |
St John's Laboratory |
100 µl |
EUR 277 |
|
Description: Eukaryotic initiation factor 2B (EIF2B), which is necessary for protein synthesis, is a GTP exchange factor composed of five different subunits. The protein encoded by this gene is the fourth, or delta, subunit. Defects in this gene are a cause of leukoencephalopathy with vanishing white matter (VWM) and ovarioleukodystrophy. Multiple transcript variants encoding different isoforms have been found for this gene. |
 Rat EIF2B4 shRNA Plasmid |
|
20-abx987370 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Human EIF2B4 shRNA Plasmid |
|
20-abx955875 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Mouse EIF2B4 shRNA Plasmid |
|
20-abx970141 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
) EIF2B4 Recombinant Protein (Human) |
|
RP010372 |
ABM |
100 ug |
Ask for price |
) EIF2B4 Recombinant Protein (Rat) |
|
RP199310 |
ABM |
100 ug |
Ask for price |
) EIF2B4 Recombinant Protein (Mouse) |
|
RP131225 |
ABM |
100 ug |
Ask for price |
EIF2B4 Recombinant Protein (Mouse) |
|
RP131228 |
ABM |
100 ug |
Ask for price |
EIF2B4 Recombinant Protein (Mouse) |
|
RP131231 |
ABM |
100 ug |
Ask for price |
 (pORF)) Eif2b4 ORF Vector (Rat) (pORF) |
|
ORF066438 |
ABM |
1.0 ug DNA |
EUR 506 |
 (pORF)) EIF2B4 ORF Vector (Human) (pORF) |
|
ORF003458 |
ABM |
1.0 ug DNA |
EUR 95 |
 (pORF)) Eif2b4 ORF Vector (Mouse) (pORF) |
|
ORF043743 |
ABM |
1.0 ug DNA |
EUR 506 |
Eif2b4 ORF Vector (Mouse) (pORF) |
|
ORF043744 |
ABM |
1.0 ug DNA |
EUR 506 |
Eif2b4 ORF Vector (Mouse) (pORF) |
|
ORF043745 |
ABM |
1.0 ug DNA |
EUR 506 |
) EIF2B4 sgRNA CRISPR Lentivector set (Human) |
|
K0665801 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Eif2b4 sgRNA CRISPR Lentivector set (Rat) |
|
K7122801 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Eif2b4 sgRNA CRISPR Lentivector set (Mouse) |
|
K4617201 |
ABM |
3 x 1.0 ug |
EUR 339 |
 (Target 1)) EIF2B4 sgRNA CRISPR Lentivector (Human) (Target 1) |
|
K0665802 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) EIF2B4 sgRNA CRISPR Lentivector (Human) (Target 2) |
|
K0665803 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) EIF2B4 sgRNA CRISPR Lentivector (Human) (Target 3) |
|
K0665804 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) Eif2b4 sgRNA CRISPR Lentivector (Rat) (Target 1) |
|
K7122802 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Eif2b4 sgRNA CRISPR Lentivector (Rat) (Target 2) |
|
K7122803 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Eif2b4 sgRNA CRISPR Lentivector (Rat) (Target 3) |
|
K7122804 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) Eif2b4 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
|
K4617202 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Eif2b4 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
|
K4617203 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Eif2b4 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
|
K4617204 |
ABM |
1.0 ug DNA |
EUR 154 |
 (pPB-C-His)) EIF2B4 Protein Vector (Mouse) (pPB-C-His) |
|
PV174970 |
ABM |
500 ng |
EUR 603 |
 (pPB-N-His)) EIF2B4 Protein Vector (Mouse) (pPB-N-His) |
|
PV174971 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-HA)) EIF2B4 Protein Vector (Mouse) (pPM-C-HA) |
|
PV174972 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-His)) EIF2B4 Protein Vector (Mouse) (pPM-C-His) |
|
PV174973 |
ABM |
500 ng |
EUR 603 |
EIF2B4 Protein Vector (Mouse) (pPB-C-His) |
|
PV174974 |
ABM |
500 ng |
EUR 603 |
EIF2B4 Protein Vector (Mouse) (pPB-N-His) |
|
PV174975 |
ABM |
500 ng |
EUR 603 |
EIF2B4 Protein Vector (Mouse) (pPM-C-HA) |
|
PV174976 |
ABM |
500 ng |
EUR 603 |
EIF2B4 Protein Vector (Mouse) (pPM-C-His) |
|
PV174977 |
ABM |
500 ng |
EUR 603 |
EIF2B4 Protein Vector (Mouse) (pPB-C-His) |
|
PV174978 |
ABM |
500 ng |
EUR 603 |
EIF2B4 Protein Vector (Mouse) (pPB-N-His) |
|
PV174979 |
ABM |
500 ng |
EUR 603 |
EIF2B4 Protein Vector (Mouse) (pPM-C-HA) |
|
PV174980 |
ABM |
500 ng |
EUR 603 |
EIF2B4 Protein Vector (Mouse) (pPM-C-His) |
|
PV174981 |
ABM |
500 ng |
EUR 603 |
 (pPB-C-His)) EIF2B4 Protein Vector (Rat) (pPB-C-His) |
|
PV265750 |
ABM |
500 ng |
EUR 603 |
 (pPB-N-His)) EIF2B4 Protein Vector (Rat) (pPB-N-His) |
|
PV265751 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-HA)) EIF2B4 Protein Vector (Rat) (pPM-C-HA) |
|
PV265752 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-His)) EIF2B4 Protein Vector (Rat) (pPM-C-His) |
|
PV265753 |
ABM |
500 ng |
EUR 603 |
 (pPB-C-His)) EIF2B4 Protein Vector (Human) (pPB-C-His) |
|
PV013829 |
ABM |
500 ng |
EUR 329 |
 (pPB-N-His)) EIF2B4 Protein Vector (Human) (pPB-N-His) |
|
PV013830 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-HA)) EIF2B4 Protein Vector (Human) (pPM-C-HA) |
|
PV013831 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-His)) EIF2B4 Protein Vector (Human) (pPM-C-His) |
|
PV013832 |
ABM |
500 ng |
EUR 329 |
 Eif2b4 3'UTR GFP Stable Cell Line |
|
TU155702 |
ABM |
1.0 ml |
Ask for price |
 Eif2b4 3'UTR Luciferase Stable Cell Line |
|
TU105702 |
ABM |
1.0 ml |
Ask for price |
Eif2b4 3'UTR Luciferase Stable Cell Line |
|
TU203870 |
ABM |
1.0 ml |
Ask for price |
Eif2b4 3'UTR GFP Stable Cell Line |
|
TU253870 |
ABM |
1.0 ml |
Ask for price |
 EIF2B4 3'UTR GFP Stable Cell Line |
|
TU056712 |
ABM |
1.0 ml |
EUR 1521 |
 EIF2B4 3'UTR Luciferase Stable Cell Line |
|
TU006712 |
ABM |
1.0 ml |
EUR 1521 |
 (CMV) (pLenti-GIII-CMV)) EIF2B4 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV) |
|
LV679021 |
ABM |
1.0 ug DNA |
EUR 682 |
 (UbC) (pLenti-GIII-UbC)) EIF2B4 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC) |
|
LV679025 |
ABM |
1.0 ug DNA |
EUR 682 |
 (EF1a) (pLenti-GIII-EF1a)) EIF2B4 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a) |
|
LV679026 |
ABM |
1.0 ug DNA |
EUR 682 |
 Antibody) Eukaryotic Translation Initiation Factor 2B Subunit Delta (EIF2B4) Antibody |
|
20-abx014962 |
Abbexa |
-
EUR 314.00
-
EUR 98.00
-
EUR 398.00
-
EUR 495.00
|
-
100 ug
-
10 ug
-
200 ug
-
300 µg
|
- Shipped within 5-10 working days.
|
Eukaryotic Translation Initiation Factor 2B Subunit Delta (EIF2B4) Antibody |
|
20-abx112368 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Eukaryotic Translation Initiation Factor 2B Subunit Delta (EIF2B4) Antibody |
|
abx036102-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Eukaryotic Translation Initiation Factor 2B Subunit Delta (EIF2B4) Antibody |
|
20-abx133099 |
Abbexa |
-
EUR 300.00
-
EUR 439.00
-
EUR 189.00
|
|
- Shipped within 5-10 working days.
|
Eukaryotic Translation Initiation Factor 2B Subunit Delta (EIF2B4) Antibody |
|
abx330942-100ul |
Abbexa |
100 ul |
EUR 425 |
- Shipped within 5-10 working days.
|
Eukaryotic Translation Initiation Factor 2B Subunit Delta (EIF2B4) Antibody |
|
20-abx327992 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Eukaryotic Translation Initiation Factor 2B Subunit Delta (EIF2B4) Antibody |
|
abx431226-200ul |
Abbexa |
200 ul |
EUR 384 |
- Shipped within 1-3 working days.
|
Eukaryotic Translation Initiation Factor 2B Subunit Delta (EIF2B4) Antibody |
|
abx232696-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
) EIF2B4 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human) |
|
K0665805 |
ABM |
3 x 1.0 ug |
EUR 376 |
) Eif2b4 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat) |
|
K7122805 |
ABM |
3 x 1.0 ug |
EUR 376 |
) Eif2b4 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse) |
|
K4617205 |
ABM |
3 x 1.0 ug |
EUR 376 |
 ELISA Kit) Human Eukaryotic Translation Initiation Factor 2B Subunit Delta (EIF2B4) ELISA Kit |
|
abx387087-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
 (CMV) (pLenti-GIII-CMV-C-term-HA)) EIF2B4 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA) |
|
LV679022 |
ABM |
1.0 ug DNA |
EUR 682 |
 (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)) EIF2B4 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro) |
|
LV679023 |
ABM |
1.0 ug DNA |
EUR 740 |
 (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)) EIF2B4 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro) |
|
LV679024 |
ABM |
1.0 ug DNA |
EUR 740 |
 (Target 1)) EIF2B4 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1) |
|
K0665806 |
ABM |
1.0 ug DNA |
EUR 167 |
The aim of this paper is to report the rationale and research design of this research.Within the Wholesome College Lunch venture youngsters in grades 5-8 (aged 8-12 years) of three main colleges within the Netherlands will obtain a wholesome college lunch for a 6-month interval.
To reply analysis query 1, lunch consumption knowledge might be collected at baseline and once more at 3- and 6-months. This might be measured with lunch images and questionnaires amongst youngsters. To reply the second analysis query, a quasi-experimental, pre-test post-test intervention-comparison group design (Three intervention colleges and three comparability colleges) might be carried out. Potential compensation results might be measured with a single transient questionnaire amongst dad and mom on the three intervention and three comparability colleges at month 6 of the lunch interval.
The varsity lunch may even be evaluated by dad and mom (dialogue teams) and lecturers and help workers (transient questionnaires).Outcomes of this research will present priceless info to affect future college lunch interventions and insurance policies.This research is registered on the Netherlands trial register (NTR): trialregister.nl, Trial NL7402 (NTR7618), registered retrospectively at 2018-11-13.
