Improving dietary intake during lunch through the provision of a healthy school lunch at Dutch primary schools: design of a pretest-posttest effectiveness study.

Since there’s a shift from consuming lunch at house to consuming lunch at main colleges within the Netherlands, offering a faculty lunch could also be an vital alternative to enhance the weight loss program high quality of Dutch youngsters.

Due to this fact, the intention of this Wholesome College Lunch venture is to encourage wholesome consuming conduct of youngsters at main colleges by providing a wholesome college lunch, primarily based on the rules for a nutritious diet. On this research, two analysis questions might be addressed.

The primary analysis query is: What and the way a lot do youngsters eat from a self-served college lunch and the way do they consider the lunch? The second analysis query is: Do youngsters compensate more healthy college lunches by consuming much less wholesome exterior college hours?

EIF2B4 antibody

70R-17041 50 ul
EUR 435
Description: Rabbit polyclonal EIF2B4 antibody

EIF2B4 Antibody

35107-100ul 100ul
EUR 252

EIF2B4 Antibody

35107-50ul 50ul
EUR 187

EIF2B4 Antibody

EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against EIF2B4. Recognizes EIF2B4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

EIF2B4 Antibody

CSB-PA933060-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against EIF2B4. Recognizes EIF2B4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

EIF2B4 Antibody

DF4577 200ul
EUR 304
Description: EIF2B4 Antibody detects endogenous levels of total EIF2B4.

EIF2B4 antibody

70R-36819 100 ug
EUR 349
Description: Rabbit Polyclonal EIF2B4 antibody

EIF2B4 Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against EIF2B4. Recognizes EIF2B4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/5000

EIF2B4 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against EIF2B4. Recognizes EIF2B4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

EIF2B4 Antibody

ABD4577 100 ug
EUR 438

EIF2B4 Blocking Peptide

DF4577-BP 1mg
EUR 195

EIF2B4 Blocking Peptide

  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

EIF2B4 Conjugated Antibody

C35107 100ul
EUR 397

EIF2B4 cloning plasmid

CSB-CL887053HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1572
  • Sequence: atggctgctgtggccgtggctgttcgcgaggactcgggatccgggatgaaggcggagcttccccctgggcctggggcagtggggagggaaatgaccaaagaagaaaagctgcagcttcggaaggaaaagaaacagcagaagaagaaacggaaggaagaaaagggggcagaaccag
  • Show more
Description: A cloning plasmid for the EIF2B4 gene.

EIF2B4 Rabbit pAb

A18203-100ul 100 ul
EUR 308

EIF2B4 Rabbit pAb

A18203-200ul 200 ul
EUR 459

EIF2B4 Rabbit pAb

A18203-20ul 20 ul
EUR 183

EIF2B4 Rabbit pAb

A18203-50ul 50 ul
EUR 223

anti- EIF2B4 antibody

FNab02696 100µg
EUR 505.25
  • Immunogen: eukaryotic translation initiation factor 2B, subunit 4 delta, 67kDa
  • Uniprot ID: Q9UI10
  • Gene ID: 8890
  • Research Area: Metabolism
Description: Antibody raised against EIF2B4

Anti-EIF2B4 antibody

PAab02696 100 ug
EUR 355

Anti-EIF2B4 antibody

STJ11100161 100 µl
EUR 277
Description: Eukaryotic initiation factor 2B (EIF2B), which is necessary for protein synthesis, is a GTP exchange factor composed of five different subunits. The protein encoded by this gene is the fourth, or delta, subunit. Defects in this gene are a cause of leukoencephalopathy with vanishing white matter (VWM) and ovarioleukodystrophy. Multiple transcript variants encoding different isoforms have been found for this gene.

Anti-EIF2B4 antibody

STJ72304 100 µg
EUR 359

Mouse Eif2b4 ELISA KIT

ELI-08648m 96 Tests
EUR 865


EF009332 96 Tests
EUR 689

Rat EIF2B4 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human EIF2B4 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse EIF2B4 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.


ELI-32260h 96 Tests
EUR 824


ELI-47580b 96 Tests
EUR 928

EIF2B4 Recombinant Protein (Human)

RP010372 100 ug Ask for price

EIF2B4 Recombinant Protein (Rat)

RP199310 100 ug Ask for price

EIF2B4 Recombinant Protein (Mouse)

RP131225 100 ug Ask for price

EIF2B4 Recombinant Protein (Mouse)

RP131228 100 ug Ask for price

EIF2B4 Recombinant Protein (Mouse)

RP131231 100 ug Ask for price

Eif2b4 ORF Vector (Rat) (pORF)

ORF066438 1.0 ug DNA
EUR 506

EIF2B4 ORF Vector (Human) (pORF)

ORF003458 1.0 ug DNA
EUR 95

Eif2b4 ORF Vector (Mouse) (pORF)

ORF043743 1.0 ug DNA
EUR 506

Eif2b4 ORF Vector (Mouse) (pORF)

ORF043744 1.0 ug DNA
EUR 506

Eif2b4 ORF Vector (Mouse) (pORF)

ORF043745 1.0 ug DNA
EUR 506

EIF2B4 sgRNA CRISPR Lentivector set (Human)

K0665801 3 x 1.0 ug
EUR 339

Eif2b4 sgRNA CRISPR Lentivector set (Rat)

K7122801 3 x 1.0 ug
EUR 339

Eif2b4 sgRNA CRISPR Lentivector set (Mouse)

K4617201 3 x 1.0 ug
EUR 339

EIF2B4 sgRNA CRISPR Lentivector (Human) (Target 1)

K0665802 1.0 ug DNA
EUR 154

EIF2B4 sgRNA CRISPR Lentivector (Human) (Target 2)

K0665803 1.0 ug DNA
EUR 154

EIF2B4 sgRNA CRISPR Lentivector (Human) (Target 3)

K0665804 1.0 ug DNA
EUR 154

Eif2b4 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7122802 1.0 ug DNA
EUR 154

Eif2b4 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7122803 1.0 ug DNA
EUR 154

Eif2b4 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7122804 1.0 ug DNA
EUR 154

Eif2b4 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4617202 1.0 ug DNA
EUR 154

Eif2b4 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4617203 1.0 ug DNA
EUR 154

Eif2b4 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4617204 1.0 ug DNA
EUR 154

EIF2B4 Protein Vector (Mouse) (pPB-C-His)

PV174970 500 ng
EUR 603

EIF2B4 Protein Vector (Mouse) (pPB-N-His)

PV174971 500 ng
EUR 603

EIF2B4 Protein Vector (Mouse) (pPM-C-HA)

PV174972 500 ng
EUR 603

EIF2B4 Protein Vector (Mouse) (pPM-C-His)

PV174973 500 ng
EUR 603

EIF2B4 Protein Vector (Mouse) (pPB-C-His)

PV174974 500 ng
EUR 603

EIF2B4 Protein Vector (Mouse) (pPB-N-His)

PV174975 500 ng
EUR 603

EIF2B4 Protein Vector (Mouse) (pPM-C-HA)

PV174976 500 ng
EUR 603

EIF2B4 Protein Vector (Mouse) (pPM-C-His)

PV174977 500 ng
EUR 603

EIF2B4 Protein Vector (Mouse) (pPB-C-His)

PV174978 500 ng
EUR 603

EIF2B4 Protein Vector (Mouse) (pPB-N-His)

PV174979 500 ng
EUR 603

EIF2B4 Protein Vector (Mouse) (pPM-C-HA)

PV174980 500 ng
EUR 603

EIF2B4 Protein Vector (Mouse) (pPM-C-His)

PV174981 500 ng
EUR 603

EIF2B4 Protein Vector (Rat) (pPB-C-His)

PV265750 500 ng
EUR 603

EIF2B4 Protein Vector (Rat) (pPB-N-His)

PV265751 500 ng
EUR 603

EIF2B4 Protein Vector (Rat) (pPM-C-HA)

PV265752 500 ng
EUR 603

EIF2B4 Protein Vector (Rat) (pPM-C-His)

PV265753 500 ng
EUR 603

EIF2B4 Protein Vector (Human) (pPB-C-His)

PV013829 500 ng
EUR 329

EIF2B4 Protein Vector (Human) (pPB-N-His)

PV013830 500 ng
EUR 329

EIF2B4 Protein Vector (Human) (pPM-C-HA)

PV013831 500 ng
EUR 329

EIF2B4 Protein Vector (Human) (pPM-C-His)

PV013832 500 ng
EUR 329

Eif2b4 3'UTR GFP Stable Cell Line

TU155702 1.0 ml Ask for price

Eif2b4 3'UTR Luciferase Stable Cell Line

TU105702 1.0 ml Ask for price

Eif2b4 3'UTR Luciferase Stable Cell Line

TU203870 1.0 ml Ask for price

Eif2b4 3'UTR GFP Stable Cell Line

TU253870 1.0 ml Ask for price

EIF2B4 3'UTR GFP Stable Cell Line

TU056712 1.0 ml
EUR 1521

EIF2B4 3'UTR Luciferase Stable Cell Line

TU006712 1.0 ml
EUR 1521

EIF2B4 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV679021 1.0 ug DNA
EUR 682

EIF2B4 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV679025 1.0 ug DNA
EUR 682

EIF2B4 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV679026 1.0 ug DNA
EUR 682

Eukaryotic Translation Initiation Factor 2B Subunit Delta (EIF2B4) Antibody

  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

Eukaryotic Translation Initiation Factor 2B Subunit Delta (EIF2B4) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Eukaryotic Translation Initiation Factor 2B Subunit Delta (EIF2B4) Antibody

abx036102-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Eukaryotic Translation Initiation Factor 2B Subunit Delta (EIF2B4) Antibody

  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Eukaryotic Translation Initiation Factor 2B Subunit Delta (EIF2B4) Antibody

abx330942-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.

Eukaryotic Translation Initiation Factor 2B Subunit Delta (EIF2B4) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Eukaryotic Translation Initiation Factor 2B Subunit Delta (EIF2B4) Antibody

abx431226-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Eukaryotic Translation Initiation Factor 2B Subunit Delta (EIF2B4) Antibody

abx232696-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

EIF2B4 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K0665805 3 x 1.0 ug
EUR 376

Eif2b4 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K7122805 3 x 1.0 ug
EUR 376

Eif2b4 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K4617205 3 x 1.0 ug
EUR 376

Human Eukaryotic Translation Initiation Factor 2B Subunit Delta (EIF2B4) ELISA Kit

abx387087-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

EIF2B4 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)

LV679022 1.0 ug DNA
EUR 682

EIF2B4 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)

LV679023 1.0 ug DNA
EUR 740

EIF2B4 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)

LV679024 1.0 ug DNA
EUR 740

EIF2B4 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K0665806 1.0 ug DNA
EUR 167

EIF2B4 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K0665807 1.0 ug DNA
EUR 167

EIF2B4 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K0665808 1.0 ug DNA
EUR 167

Eif2b4 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)

K7122806 1.0 ug DNA
EUR 167

Eif2b4 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)

K7122807 1.0 ug DNA
EUR 167

Eif2b4 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)

K7122808 1.0 ug DNA
EUR 167

Eif2b4 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)

K4617206 1.0 ug DNA
EUR 167

Eif2b4 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)

K4617207 1.0 ug DNA
EUR 167

Eif2b4 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)

K4617208 1.0 ug DNA
EUR 167

The aim of this paper is to report the rationale and research design of this research.Within the Wholesome College Lunch venture youngsters in grades 5-8 (aged 8-12 years) of three main colleges within the Netherlands will obtain a wholesome college lunch for a 6-month interval.

To reply analysis query 1, lunch consumption knowledge might be collected at baseline and once more at 3- and 6-months. This might be measured with lunch images and questionnaires amongst youngsters. To reply the second analysis query, a quasi-experimental, pre-test post-test intervention-comparison group design (Three intervention colleges and three comparability colleges) might be carried out. Potential compensation results might be measured with a single transient questionnaire amongst dad and mom on the three intervention and three comparability colleges at month 6 of the lunch interval.

The varsity lunch may even be evaluated by dad and mom (dialogue teams) and lecturers and help workers (transient questionnaires).Outcomes of this research will present priceless info to affect future college lunch interventions and insurance policies.This research is registered on the Netherlands trial register (NTR):, Trial NL7402 (NTR7618), registered retrospectively at 2018-11-13.

Scroll to Top