Improving dietary intake during lunch through the provision of a healthy school lunch at Dutch primary schools: design of a pretest-posttest effectiveness study.

Since there’s a shift from consuming lunch at house to consuming lunch at main colleges within the Netherlands, offering a faculty lunch could also be an vital alternative to enhance the weight loss program high quality of Dutch youngsters.

Due to this fact, the intention of this Wholesome College Lunch venture is to encourage wholesome consuming conduct of youngsters at main colleges by providing a wholesome college lunch, primarily based on the rules for a nutritious diet. On this research, two analysis questions might be addressed.

The primary analysis query is: What and the way a lot do youngsters eat from a self-served college lunch and the way do they consider the lunch? The second analysis query is: Do youngsters compensate more healthy college lunches by consuming much less wholesome exterior college hours?

EIF2B4 antibody
70R-17041	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal EIF2B4 antibody

EIF2B4 Antibody
35107-100ul	SAB	100ul	EUR 252

EIF2B4 Antibody
35107-50ul	SAB	50ul	EUR 187

EIF2B4 Antibody
CSB-PA933060-	Cusabio		EUR 335
Form: liquid Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific Show more
Description: A polyclonal antibody against EIF2B4. Recognizes EIF2B4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

EIF2B4 Antibody
CSB-PA933060-100ul	Cusabio	100ul	EUR 316
Form: liquid Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific Show more
Description: A polyclonal antibody against EIF2B4. Recognizes EIF2B4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

EIF2B4 Antibody
DF4577	Affbiotech	200ul	EUR 304
Description: EIF2B4 Antibody detects endogenous levels of total EIF2B4.

EIF2B4 antibody
70R-36819	Fitzgerald	100 ug	EUR 349
Description: Rabbit Polyclonal EIF2B4 antibody

EIF2B4 Antibody
1-CSB-PA010573	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against EIF2B4. Recognizes EIF2B4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/5000

EIF2B4 Antibody
1-CSB-PA007517GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against EIF2B4. Recognizes EIF2B4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

EIF2B4 siRNA
20-abx901674	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

EIF2B4 siRNA
20-abx915145	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

EIF2B4 siRNA
20-abx915146	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

EIF2B4 Antibody
ABD4577	Lifescience Market	100 ug	EUR 438

EIF2B4 Blocking Peptide
DF4577-BP	Affbiotech	1mg	EUR 195

EIF2B4 Blocking Peptide
20-abx161838	Abbexa	EUR 272.00 EUR 411.00	1 mg 5 mg
Shipped within 5-10 working days.

EIF2B4 Conjugated Antibody
C35107	SAB	100ul	EUR 397

EIF2B4 cloning plasmid
CSB-CL887053HU-10ug	Cusabio	10ug	EUR 376
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1572 Sequence: atggctgctgtggccgtggctgttcgcgaggactcgggatccgggatgaaggcggagcttccccctgggcctggggcagtggggagggaaatgaccaaagaagaaaagctgcagcttcggaaggaaaagaaacagcagaagaagaaacggaaggaagaaaagggggcagaaccag Show more
Description: A cloning plasmid for the EIF2B4 gene.

EIF2B4 Rabbit pAb
A18203-100ul	Abclonal	100 ul	EUR 308

EIF2B4 Rabbit pAb
A18203-200ul	Abclonal	200 ul	EUR 459

EIF2B4 Rabbit pAb
A18203-20ul	Abclonal	20 ul	EUR 183

EIF2B4 Rabbit pAb
A18203-50ul	Abclonal	50 ul	EUR 223

anti- EIF2B4 antibody
FNab02696	FN Test	100µg	EUR 505.25
Immunogen: eukaryotic translation initiation factor 2B, subunit 4 delta, 67kDa Uniprot ID: Q9UI10 Gene ID: 8890 Research Area: Metabolism
Description: Antibody raised against EIF2B4

Anti-EIF2B4 antibody
PAab02696	Lifescience Market	100 ug	EUR 355

Anti-EIF2B4 antibody
STJ11100161	St John's Laboratory	100 µl	EUR 277
Description: Eukaryotic initiation factor 2B (EIF2B), which is necessary for protein synthesis, is a GTP exchange factor composed of five different subunits. The protein encoded by this gene is the fourth, or delta, subunit. Defects in this gene are a cause of leukoencephalopathy with vanishing white matter (VWM) and ovarioleukodystrophy. Multiple transcript variants encoding different isoforms have been found for this gene.

Anti-EIF2B4 antibody
STJ72304	St John's Laboratory	100 µg	EUR 359

Mouse Eif2b4 ELISA KIT
ELI-08648m	Lifescience Market	96 Tests	EUR 865

EIF2B4 ELISA KIT|Human
EF009332	Lifescience Market	96 Tests	EUR 689

Rat EIF2B4 shRNA Plasmid
20-abx987370	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human EIF2B4 shRNA Plasmid
20-abx955875	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse EIF2B4 shRNA Plasmid
20-abx970141	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human EIF2B4 ELISA KIT
ELI-32260h	Lifescience Market	96 Tests	EUR 824

Bovine EIF2B4 ELISA KIT
ELI-47580b	Lifescience Market	96 Tests	EUR 928

EIF2B4 Recombinant Protein (Human)
RP010372	ABM	100 ug	Ask for price

EIF2B4 Recombinant Protein (Rat)
RP199310	ABM	100 ug	Ask for price

EIF2B4 Recombinant Protein (Mouse)
RP131225	ABM	100 ug	Ask for price

EIF2B4 Recombinant Protein (Mouse)
RP131228	ABM	100 ug	Ask for price

EIF2B4 Recombinant Protein (Mouse)
RP131231	ABM	100 ug	Ask for price

Eif2b4 ORF Vector (Rat) (pORF)
ORF066438	ABM	1.0 ug DNA	EUR 506

EIF2B4 ORF Vector (Human) (pORF)
ORF003458	ABM	1.0 ug DNA	EUR 95

Eif2b4 ORF Vector (Mouse) (pORF)
ORF043743	ABM	1.0 ug DNA	EUR 506

Eif2b4 ORF Vector (Mouse) (pORF)
ORF043744	ABM	1.0 ug DNA	EUR 506

Eif2b4 ORF Vector (Mouse) (pORF)
ORF043745	ABM	1.0 ug DNA	EUR 506

EIF2B4 sgRNA CRISPR Lentivector set (Human)
K0665801	ABM	3 x 1.0 ug	EUR 339

Eif2b4 sgRNA CRISPR Lentivector set (Rat)
K7122801	ABM	3 x 1.0 ug	EUR 339

Eif2b4 sgRNA CRISPR Lentivector set (Mouse)
K4617201	ABM	3 x 1.0 ug	EUR 339

EIF2B4 sgRNA CRISPR Lentivector (Human) (Target 1)
K0665802	ABM	1.0 ug DNA	EUR 154

EIF2B4 sgRNA CRISPR Lentivector (Human) (Target 2)
K0665803	ABM	1.0 ug DNA	EUR 154

EIF2B4 sgRNA CRISPR Lentivector (Human) (Target 3)
K0665804	ABM	1.0 ug DNA	EUR 154

Eif2b4 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7122802	ABM	1.0 ug DNA	EUR 154

Eif2b4 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7122803	ABM	1.0 ug DNA	EUR 154

Eif2b4 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7122804	ABM	1.0 ug DNA	EUR 154

Eif2b4 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4617202	ABM	1.0 ug DNA	EUR 154

Eif2b4 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4617203	ABM	1.0 ug DNA	EUR 154

Eif2b4 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4617204	ABM	1.0 ug DNA	EUR 154

EIF2B4 Protein Vector (Mouse) (pPB-C-His)
PV174970	ABM	500 ng	EUR 603

EIF2B4 Protein Vector (Mouse) (pPB-N-His)
PV174971	ABM	500 ng	EUR 603

EIF2B4 Protein Vector (Mouse) (pPM-C-HA)
PV174972	ABM	500 ng	EUR 603

EIF2B4 Protein Vector (Mouse) (pPM-C-His)
PV174973	ABM	500 ng	EUR 603

EIF2B4 Protein Vector (Mouse) (pPB-C-His)
PV174974	ABM	500 ng	EUR 603

EIF2B4 Protein Vector (Mouse) (pPB-N-His)
PV174975	ABM	500 ng	EUR 603

EIF2B4 Protein Vector (Mouse) (pPM-C-HA)
PV174976	ABM	500 ng	EUR 603

EIF2B4 Protein Vector (Mouse) (pPM-C-His)
PV174977	ABM	500 ng	EUR 603

EIF2B4 Protein Vector (Mouse) (pPB-C-His)
PV174978	ABM	500 ng	EUR 603

EIF2B4 Protein Vector (Mouse) (pPB-N-His)
PV174979	ABM	500 ng	EUR 603

EIF2B4 Protein Vector (Mouse) (pPM-C-HA)
PV174980	ABM	500 ng	EUR 603

EIF2B4 Protein Vector (Mouse) (pPM-C-His)
PV174981	ABM	500 ng	EUR 603

EIF2B4 Protein Vector (Rat) (pPB-C-His)
PV265750	ABM	500 ng	EUR 603

EIF2B4 Protein Vector (Rat) (pPB-N-His)
PV265751	ABM	500 ng	EUR 603

EIF2B4 Protein Vector (Rat) (pPM-C-HA)
PV265752	ABM	500 ng	EUR 603

EIF2B4 Protein Vector (Rat) (pPM-C-His)
PV265753	ABM	500 ng	EUR 603

EIF2B4 Protein Vector (Human) (pPB-C-His)
PV013829	ABM	500 ng	EUR 329

EIF2B4 Protein Vector (Human) (pPB-N-His)
PV013830	ABM	500 ng	EUR 329

EIF2B4 Protein Vector (Human) (pPM-C-HA)
PV013831	ABM	500 ng	EUR 329

EIF2B4 Protein Vector (Human) (pPM-C-His)
PV013832	ABM	500 ng	EUR 329

Eif2b4 3'UTR GFP Stable Cell Line
TU155702	ABM	1.0 ml	Ask for price

Eif2b4 3'UTR Luciferase Stable Cell Line
TU105702	ABM	1.0 ml	Ask for price

Eif2b4 3'UTR Luciferase Stable Cell Line
TU203870	ABM	1.0 ml	Ask for price

Eif2b4 3'UTR GFP Stable Cell Line
TU253870	ABM	1.0 ml	Ask for price

EIF2B4 3'UTR GFP Stable Cell Line
TU056712	ABM	1.0 ml	EUR 1521

EIF2B4 3'UTR Luciferase Stable Cell Line
TU006712	ABM	1.0 ml	EUR 1521

EIF2B4 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV679021	ABM	1.0 ug DNA	EUR 682

EIF2B4 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV679025	ABM	1.0 ug DNA	EUR 682

EIF2B4 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV679026	ABM	1.0 ug DNA	EUR 682

Eukaryotic Translation Initiation Factor 2B Subunit Delta (EIF2B4) Antibody
20-abx014962	Abbexa	EUR 314.00 EUR 98.00 EUR 398.00 EUR 495.00	100 ug 10 ug 200 ug 300 µg
Shipped within 5-10 working days.

Eukaryotic Translation Initiation Factor 2B Subunit Delta (EIF2B4) Antibody
20-abx112368	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Eukaryotic Translation Initiation Factor 2B Subunit Delta (EIF2B4) Antibody
abx036102-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Eukaryotic Translation Initiation Factor 2B Subunit Delta (EIF2B4) Antibody
20-abx133099	Abbexa	EUR 300.00 EUR 439.00 EUR 189.00	100 ul 200 ul 30 ul
Shipped within 5-10 working days.

Eukaryotic Translation Initiation Factor 2B Subunit Delta (EIF2B4) Antibody
abx330942-100ul	Abbexa	100 ul	EUR 425
Shipped within 5-10 working days.

Eukaryotic Translation Initiation Factor 2B Subunit Delta (EIF2B4) Antibody
20-abx327992	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

Eukaryotic Translation Initiation Factor 2B Subunit Delta (EIF2B4) Antibody
abx431226-200ul	Abbexa	200 ul	EUR 384
Shipped within 1-3 working days.

Eukaryotic Translation Initiation Factor 2B Subunit Delta (EIF2B4) Antibody
abx232696-100ug	Abbexa	100 ug	EUR 481
Shipped within 5-12 working days.

EIF2B4 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K0665805	ABM	3 x 1.0 ug	EUR 376

Eif2b4 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)
K7122805	ABM	3 x 1.0 ug	EUR 376

Eif2b4 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
K4617205	ABM	3 x 1.0 ug	EUR 376

Human Eukaryotic Translation Initiation Factor 2B Subunit Delta (EIF2B4) ELISA Kit
abx387087-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

EIF2B4 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)
LV679022	ABM	1.0 ug DNA	EUR 682

EIF2B4 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)
LV679023	ABM	1.0 ug DNA	EUR 740

EIF2B4 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)
LV679024	ABM	1.0 ug DNA	EUR 740

EIF2B4 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)
K0665806	ABM	1.0 ug DNA	EUR 167

EIF2B4 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)
K0665807	ABM	1.0 ug DNA	EUR 167

EIF2B4 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)
K0665808	ABM	1.0 ug DNA	EUR 167

Eif2b4 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)
K7122806	ABM	1.0 ug DNA	EUR 167

Eif2b4 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)
K7122807	ABM	1.0 ug DNA	EUR 167

Eif2b4 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)
K7122808	ABM	1.0 ug DNA	EUR 167

Eif2b4 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)
K4617206	ABM	1.0 ug DNA	EUR 167

Eif2b4 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)
K4617207	ABM	1.0 ug DNA	EUR 167

Eif2b4 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)
K4617208	ABM	1.0 ug DNA	EUR 167

The aim of this paper is to report the rationale and research design of this research.Within the Wholesome College Lunch venture youngsters in grades 5-8 (aged 8-12 years) of three main colleges within the Netherlands will obtain a wholesome college lunch for a 6-month interval.

To reply analysis query 1, lunch consumption knowledge might be collected at baseline and once more at 3- and 6-months. This might be measured with lunch images and questionnaires amongst youngsters. To reply the second analysis query, a quasi-experimental, pre-test post-test intervention-comparison group design (Three intervention colleges and three comparability colleges) might be carried out. Potential compensation results might be measured with a single transient questionnaire amongst dad and mom on the three intervention and three comparability colleges at month 6 of the lunch interval.

The varsity lunch may even be evaluated by dad and mom (dialogue teams) and lecturers and help workers (transient questionnaires).Outcomes of this research will present priceless info to affect future college lunch interventions and insurance policies.This research is registered on the Netherlands trial register (NTR): trialregister.nl, Trial NL7402 (NTR7618), registered retrospectively at 2018-11-13.