Gender sensitivity in career mentoring - a project report from the Medical Faculty of Leipzig University.

Gender sensitivity in career mentoring – a project report from the Medical Faculty of Leipzig University.

Goal: The elective topic “profession administration for medical college students” is introduced for example of educating gender sensitivity points amongst medical research at Leipzig College. The venture report exhibits the interim outcomes of selling gender-sensitive educating on the Medical School of Leipzig College, in addition to the elective’s contribution to the event of gender sensitivity on the complete college.

Technique: Challenge Description and Outcomes present the group/process, individuals and detailed contents of the elective because it started in Winter Time period 2010/11. The analysis examines the elective’s mandate on the Medical School and past, i.e. by evaluating with the efforts of different universities.

Outcomes: The elective is the primary topic for credit score inside the medical curriculum of medical research at Leipzig College that connects the matters of gender sensitivity and profession administration. It creates a view of the specialties of medication and analysis as they relate to gender, and likewise on the choices of a medical profession and touches the subject of gender equality.

A college survey within the winter semester of 2011/12 reveals that just about one third of the medical college students need an extension of the curriculum across the subject of gender and even an unbiased topic “Gender Medication”. The elective is a part of a cycle selling gender equality at Leipzig College.

Conclusion: The elective initiates and continues the implementation of gender-sensitive educating on the Medical School of Leipzig College. The administration of the elective goals on the everlasting institution of the topic within the curriculum with a purpose to encourage profession ambitions early – particularly for ladies.

Gender sensitivity in career mentoring - a project report from the Medical Faculty of Leipzig University.
Gender sensitivity in profession mentoring – a venture report from the Medical School of Leipzig College.

Salutogenic qualities of midwifery care: A best-fit framework synthesis.

Though midwifery care is wellness-based and promotes regular physiology, it exists inside a medical mannequin that focuses on danger aversion and illness prevention. Salutogenic principle might present an alternate strategy to midwifery care, supporting health-promoting elements, reasonably than solely avoiding adversarial occasions.The goal of this research was to discover ladies’s experiences of their midwifery care and determine salutogenic elements of midwifery care.Greatest-fit framework synthesis was used to analyse 349 quotes about ladies’s experiences of midwifery care from 31 qualitative research in ten high-income international locations.

EIF2B1 siRNA

20-abx901673
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

EIF2B1 Protein

20-abx263439
  • EUR 230.00
  • EUR 1609.00
  • EUR 328.00
  • 1 µg
  • 50 ug
  • 5 ug
  • Shipped within 5-10 working days.

EIF2B1 siRNA

20-abx915139
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

EIF2B1 siRNA

20-abx915140
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

EIF2B1 antibody

70R-3849 50 ug
EUR 467
Description: Rabbit polyclonal EIF2B1 antibody raised against the C terminal of EIF2B1

EIF2B1 antibody

70R-17038 50 ul
EUR 435
Description: Rabbit polyclonal EIF2B1 antibody

EIF2B1 Antibody

DF12392 200ul
EUR 304
Description: EIF2B1 antibody detects endogenous levels of EIF2B1.

EIF2B1 Antibody

1-CSB-PA007514GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against EIF2B1. Recognizes EIF2B1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF

EIF2B1 Antibody

1-CSB-PA623910ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against EIF2B1. Recognizes EIF2B1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

EIF2B1 Antibody

1-CSB-PA623910ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against EIF2B1. Recognizes EIF2B1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

anti-EIF2B1

YF-PA11516 50 ug
EUR 363
Description: Mouse polyclonal to EIF2B1

anti- EIF2B1 antibody

FNab02693 100µg
EUR 585
  • Immunogen: eukaryotic translation initiation factor 2B, subunit 1 alpha, 26kDa
  • Uniprot ID: Q14232
  • Gene ID: 1967
  • Research Area: Metabolism
Description: Antibody raised against EIF2B1

EIF2B1 Rabbit pAb

A7892-100ul 100 ul
EUR 308

EIF2B1 Rabbit pAb

A7892-200ul 200 ul
EUR 459

EIF2B1 Rabbit pAb

A7892-20ul 20 ul
EUR 183

EIF2B1 Rabbit pAb

A7892-50ul 50 ul
EUR 223

EIF2B1 Blocking Peptide

33R-1107 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ACBD5 antibody, catalog no. 70R-6731

EIF2B1 Polyclonal Antibody

31370-100ul 100ul
EUR 252

EIF2B1 Polyclonal Antibody

31370-50ul 50ul
EUR 187

EIF2B1 Blocking Peptide

DF12392-BP 1mg
EUR 195

EIF2B1 cloning plasmid

CSB-CL623910HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 918
  • Sequence: ATGGACGACAAGGAGTTAATTGAATACTTTAAGTCTCAGATGAAAGAAGATCCTGACATGGCCTCAGCAGTGGCTGCCATCCGGACGTTGCTGGAGTTCTTGAAGAGAGATAAAGGGGAGACAATCCAGGGTCTGAGGGCGAATCTCACCAGTGCCATAGAAACCCTGTGTGGTGT
  • Show more
Description: A cloning plasmid for the EIF2B1 gene.

Anti-EIF2B1 antibody

PAab02693 100 ug
EUR 412

pExpress-Eif2b1-r

PVT17590 2 ug
EUR 258

Anti-EIF2B1 antibody

STJ110201 100 µl
EUR 277
Description: This gene encodes one of five subunits of eukaryotic translation initiation factor 2B (EIF2B), a GTP exchange factor for eukaryotic initiation factor 2 and an essential regulator for protein synthesis. Mutations in this gene and the genes encoding other EIF2B subunits have been associated with leukoencephalopathy with vanishing white matter.

EIF2B1 Polyclonal Conjugated Antibody

C31370 100ul
EUR 397

Mouse EIF2B1 shRNA Plasmid

20-abx980609
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat EIF2B1 shRNA Plasmid

20-abx986264
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human EIF2B1 ELISA KIT

ELI-09622h 96 Tests
EUR 824

Bovine EIF2B1 ELISA KIT

ELI-27647b 96 Tests
EUR 928

Mouse Eif2b1 ELISA KIT

ELI-27648m 96 Tests
EUR 865

EIF2B1 ELISA KIT|Human

EF009329 96 Tests
EUR 689

Human EIF2B1 shRNA Plasmid

20-abx951361
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

EIF2B1 protein (His tag)

80R-1781 10 ug
EUR 305
Description: Purified recombinant Human EIF2B1 protein

EIF2B1 Recombinant Protein (Human)

RP038725 100 ug Ask for price

EIF2B1 Recombinant Protein (Rat)

RP199301 100 ug Ask for price

EIF2B1 Recombinant Protein (Mouse)

RP131213 100 ug Ask for price

Eif2b1 ORF Vector (Rat) (pORF)

ORF066435 1.0 ug DNA
EUR 506

Eif2b1 ORF Vector (Mouse) (pORF)

ORF043739 1.0 ug DNA
EUR 506

EIF2B1 ORF Vector (Human) (pORF)

ORF012909 1.0 ug DNA
EUR 354

EIF2B1 sgRNA CRISPR Lentivector set (Human)

K0665501 3 x 1.0 ug
EUR 339

Eif2b1 sgRNA CRISPR Lentivector set (Mouse)

K4892101 3 x 1.0 ug
EUR 339

Eif2b1 sgRNA CRISPR Lentivector set (Rat)

K7080801 3 x 1.0 ug
EUR 339

EIF2B1 sgRNA CRISPR Lentivector (Human) (Target 1)

K0665502 1.0 ug DNA
EUR 154

EIF2B1 sgRNA CRISPR Lentivector (Human) (Target 2)

K0665503 1.0 ug DNA
EUR 154

EIF2B1 sgRNA CRISPR Lentivector (Human) (Target 3)

K0665504 1.0 ug DNA
EUR 154

Eif2b1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4892102 1.0 ug DNA
EUR 154

Eif2b1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4892103 1.0 ug DNA
EUR 154

Eif2b1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4892104 1.0 ug DNA
EUR 154

Eif2b1 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7080802 1.0 ug DNA
EUR 154

Eif2b1 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7080803 1.0 ug DNA
EUR 154

Eif2b1 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7080804 1.0 ug DNA
EUR 154

EIF2B1 Protein Vector (Human) (pPB-C-His)

PV051633 500 ng
EUR 481

EIF2B1 Protein Vector (Human) (pPB-N-His)

PV051634 500 ng
EUR 481

EIF2B1 Protein Vector (Human) (pPM-C-HA)

PV051635 500 ng
EUR 481

EIF2B1 Protein Vector (Human) (pPM-C-His)

PV051636 500 ng
EUR 481

EIF2B1 Protein Vector (Mouse) (pPB-C-His)

PV174954 500 ng
EUR 603

EIF2B1 Protein Vector (Mouse) (pPB-N-His)

PV174955 500 ng
EUR 603

EIF2B1 Protein Vector (Mouse) (pPM-C-HA)

PV174956 500 ng
EUR 603

EIF2B1 Protein Vector (Mouse) (pPM-C-His)

PV174957 500 ng
EUR 603

Recombinant Human EIF2B1 Protein, GST, E.coli-100ug

QP7612-ec-100ug 100ug
EUR 408

Recombinant Human EIF2B1 Protein, GST, E.coli-10ug

QP7612-ec-10ug 10ug
EUR 200

Recombinant Human EIF2B1 Protein, GST, E.coli-1mg

QP7612-ec-1mg 1mg
EUR 1632

Recombinant Human EIF2B1 Protein, GST, E.coli-200ug

QP7612-ec-200ug 200ug
EUR 634

Recombinant Human EIF2B1 Protein, GST, E.coli-500ug

QP7612-ec-500ug 500ug
EUR 1060

Recombinant Human EIF2B1 Protein, GST, E.coli-50ug

QP7612-ec-50ug 50ug
EUR 263

EIF2B1 Protein Vector (Rat) (pPB-C-His)

PV265738 500 ng
EUR 603

EIF2B1 Protein Vector (Rat) (pPB-N-His)

PV265739 500 ng
EUR 603

EIF2B1 Protein Vector (Rat) (pPM-C-HA)

PV265740 500 ng
EUR 603

EIF2B1 Protein Vector (Rat) (pPM-C-His)

PV265741 500 ng
EUR 603

Eif2b1 3'UTR Luciferase Stable Cell Line

TU203867 1.0 ml Ask for price

Eif2b1 3'UTR GFP Stable Cell Line

TU155699 1.0 ml Ask for price

EIF2B1 3'UTR Luciferase Stable Cell Line

TU006709 1.0 ml
EUR 1394

Eif2b1 3'UTR Luciferase Stable Cell Line

TU105699 1.0 ml Ask for price

EIF2B1 3'UTR GFP Stable Cell Line

TU056709 1.0 ml
EUR 1394

Eif2b1 3'UTR GFP Stable Cell Line

TU253867 1.0 ml Ask for price

EIF2B1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV677041 1.0 ug DNA
EUR 514

EIF2B1 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV677045 1.0 ug DNA
EUR 514

EIF2B1 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV677046 1.0 ug DNA
EUR 514

EIF2B1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV703599 1.0 ug DNA
EUR 450

EIF2B1 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV703603 1.0 ug DNA
EUR 450

EIF2B1 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV703604 1.0 ug DNA
EUR 450

Eukaryotic Translation Initiation Factor 2B Subunit Alpha (EIF2B1) Antibody

20-abx112365
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Eukaryotic Translation Initiation Factor 2B Subunit Alpha (eIF2B1) Antibody

20-abx142023
  • EUR 370.00
  • EUR 606.00
  • EUR 300.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Eukaryotic Translation Initiation Factor 2B Subunit Alpha (EIF2B1) Antibody

20-abx007084
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Eukaryotic Translation Initiation Factor 2B Subunit Alpha (EIF2B1) Antibody

20-abx320993
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Eukaryotic Translation Initiation Factor 2B Subunit Alpha (EIF2B1) Antibody

20-abx322477
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Eukaryotic Translation Initiation Factor 2B Subunit Alpha (EIF2B1) Antibody

abx232693-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

Human Translation initiation factor eIF-2B subunit alpha (EIF2B1)

1-CSB-EP623910HU
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 60.7 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Translation initiation factor eIF-2B subunit alpha(EIF2B1) expressed in E.coli

EIF2B1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K0665505 3 x 1.0 ug
EUR 376

Eif2b1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K4892105 3 x 1.0 ug
EUR 376

Eif2b1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K7080805 3 x 1.0 ug
EUR 376

EIF2B1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K0665506 1.0 ug DNA
EUR 167

EIF2B1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K0665507 1.0 ug DNA
EUR 167

EIF2B1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K0665508 1.0 ug DNA
EUR 167

Human Eukaryotic Translation Initiation Factor 2B Subunit Alpha (EIF2B1) ELISA Kit

abx387084-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Eif2b1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)

K4892106 1.0 ug DNA
EUR 167

Eif2b1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)

K4892107 1.0 ug DNA
EUR 167

Eif2b1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)

K4892108 1.0 ug DNA
EUR 167

EIF2B1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)

LV677042 1.0 ug DNA
EUR 514

EIF2B1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)

LV677043 1.0 ug DNA
EUR 572

EIF2B1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)

LV677044 1.0 ug DNA
EUR 572

EIF2B1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-C-term-HA)

LV703600 1.0 ug DNA
EUR 450

EIF2B1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)

LV703601 1.0 ug DNA
EUR 508

EIF2B1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)

LV703602 1.0 ug DNA
EUR 508

Eif2b1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)

K7080806 1.0 ug DNA
EUR 167

Eif2b1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)

K7080807 1.0 ug DNA
EUR 167

Eif2b1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)

K7080808 1.0 ug DNA
EUR 167

EIF2B1 Eukaryotic Translation Initiation Factor 2B Subunit 1 Alpha Human Recombinant Protein

PROTQ14232 Regular: 5ug
EUR 317
Description: EIF2B1 produced in E.Coli is a single, non-glycosylated polypeptide chain containing 325 amino acids (1-305 a.a.) and having a molecular mass of 35.8kDa.;EIF2B1 is fused to a 20 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

Key salutogenic ideas of comprehensibility, manageability and meaningfulness have been used as the idea for coding, and thematic evaluation was used to develop and make clear the framework to finest match the info.Definitions for the salutogenic elements of midwifery care have been developed.

Comprehensibility (cognitive elements of well being): ways in which midwives assist ladies enhance predictability and preparation throughout childbearing by means of apredictable caregiver, a predictable system and preparation for an unpredictable expertise. Manageability (behavioural elements of well being): ways in which midwives improve and assist a lady’s inside resilience, including further assist when wanted, and strengthen ladies’s exterior sources by means of connections to household, group and specialist care.

Meaningfulness (emotional/non secular elements of well being): ways in which midwives encourage the dedication and engagement of childbearing ladies by offering care by means of a personalised relationship, by cultivating a lady’s autonomy.Findings of this research could also be used to additional analysis into ways in which salutogenic principle can carry a well being and wellness-focused agenda to midwifery coverage and follow.

Leave a Comment

Your email address will not be published. Required fields are marked *

Scroll to Top